ID: 1091220514_1091220524

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1091220514 1091220524
Species Human (GRCh38) Human (GRCh38)
Location 11:133927613-133927635 11:133927641-133927663
Sequence CCAGGGGTTTCCCCACAGTGGGG ATCCCTAAGGCCGTAAGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 165} {0: 1, 1: 0, 2: 1, 3: 2, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!