ID: 1091220518_1091220530

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1091220518 1091220530
Species Human (GRCh38) Human (GRCh38)
Location 11:133927624-133927646 11:133927671-133927693
Sequence CCCACAGTGGGGCCAGGATCCCT TCACGCTATGCATGGAGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166} {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!