ID: 1091263681_1091263691

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1091263681 1091263691
Species Human (GRCh38) Human (GRCh38)
Location 11:134253836-134253858 11:134253853-134253875
Sequence CCCCCCGGCCTGGCTCCCTACTC CTACTCCGGCCGGTCACCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 452} {0: 1, 1: 0, 2: 0, 3: 7, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!