ID: 1091286939_1091286947

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091286939 1091286947
Species Human (GRCh38) Human (GRCh38)
Location 11:134412803-134412825 11:134412841-134412863
Sequence CCCCGTGGAAGGGCACCTCGAGC TCACCCCAGCCTCCCCTTCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 78, 3: 1805, 4: 24260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!