ID: 1091293442_1091293448

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091293442 1091293448
Species Human (GRCh38) Human (GRCh38)
Location 11:134455458-134455480 11:134455491-134455513
Sequence CCTTGCTGAGACCTGCTGGGCTG GGTTAGGCATTCTAAGTCACAGG
Strand - +
Off-target summary No data {0: 149, 1: 387, 2: 774, 3: 680, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!