ID: 1091293443_1091293449

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1091293443 1091293449
Species Human (GRCh38) Human (GRCh38)
Location 11:134455469-134455491 11:134455501-134455523
Sequence CCTGCTGGGCTGCACTCCCATAG TCTAAGTCACAGGATGAGATAGG
Strand - +
Off-target summary No data {0: 488, 1: 780, 2: 613, 3: 352, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!