ID: 1091293443_1091293450 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1091293443 | 1091293450 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:134455469-134455491 | 11:134455504-134455526 |
Sequence | CCTGCTGGGCTGCACTCCCATAG | AAGTCACAGGATGAGATAGGAGG |
Strand | - | + |
Off-target summary | No data | {0: 408, 1: 684, 2: 640, 3: 404, 4: 435} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |