ID: 1091293443_1091293450

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091293443 1091293450
Species Human (GRCh38) Human (GRCh38)
Location 11:134455469-134455491 11:134455504-134455526
Sequence CCTGCTGGGCTGCACTCCCATAG AAGTCACAGGATGAGATAGGAGG
Strand - +
Off-target summary No data {0: 408, 1: 684, 2: 640, 3: 404, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!