ID: 1091324698_1091324704 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1091324698 | 1091324704 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:134677484-134677506 | 11:134677509-134677531 |
| Sequence | CCAACCTCCTGTTCCCTCCTCTC | TTCATCAGAGCCCTCTCTCTAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 13, 3: 165, 4: 1315} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||