ID: 1091353164_1091353169

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1091353164 1091353169
Species Human (GRCh38) Human (GRCh38)
Location 11:134913829-134913851 11:134913860-134913882
Sequence CCTGAGGGCTGGTGCAGTGGCAG TAAACAGCAGGCGACTCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 434} {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!