ID: 1091407165_1091407171

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1091407165 1091407171
Species Human (GRCh38) Human (GRCh38)
Location 12:216287-216309 12:216318-216340
Sequence CCTTCCTCACTCAAGTTCTCCTA GACCCACTTGGTGTTCAGACCGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 2, 3: 21, 4: 284} {0: 2, 1: 2, 2: 1, 3: 5, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!