ID: 1091407193_1091407198

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1091407193 1091407198
Species Human (GRCh38) Human (GRCh38)
Location 12:216454-216476 12:216496-216518
Sequence CCAGAGACTCTCTAATGTTGAGC CCTAGCCTCCAAGACCCACTTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 3, 4: 82} {0: 7, 1: 0, 2: 1, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!