ID: 1091407194_1091407198

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1091407194 1091407198
Species Human (GRCh38) Human (GRCh38)
Location 12:216476-216498 12:216496-216518
Sequence CCCTTCCTCACTCAAGTTCTCCT CCTAGCCTCCAAGACCCACTTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 1, 3: 33, 4: 398} {0: 7, 1: 0, 2: 1, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!