ID: 1091596408_1091596412

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1091596408 1091596412
Species Human (GRCh38) Human (GRCh38)
Location 12:1881839-1881861 12:1881861-1881883
Sequence CCAAATTTGGCCAGATGGCTTAT TGTCTACTATTAACAGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 103} {0: 1, 1: 0, 2: 2, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!