ID: 1091656237_1091656242

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1091656237 1091656242
Species Human (GRCh38) Human (GRCh38)
Location 12:2348682-2348704 12:2348696-2348718
Sequence CCAGAGGGACCCAGAGTGTGGGG AGTGTGGGGCGCCCTGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 292} {0: 1, 1: 0, 2: 2, 3: 17, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!