ID: 1091700334_1091700341

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1091700334 1091700341
Species Human (GRCh38) Human (GRCh38)
Location 12:2654844-2654866 12:2654881-2654903
Sequence CCTGTCAGAAGCAGGATCCCGGT CTCTCAGCCCCAGCTCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 53} {0: 1, 1: 0, 2: 5, 3: 61, 4: 492}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!