ID: 1091712243_1091712248

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1091712243 1091712248
Species Human (GRCh38) Human (GRCh38)
Location 12:2750264-2750286 12:2750296-2750318
Sequence CCTGCTGGTCTCCATGGAGGTGG AGCTAGACCACTTGGCTCCCTGG
Strand - +
Off-target summary No data {0: 296, 1: 590, 2: 567, 3: 309, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!