ID: 1091712243_1091712252

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1091712243 1091712252
Species Human (GRCh38) Human (GRCh38)
Location 12:2750264-2750286 12:2750315-2750337
Sequence CCTGCTGGTCTCCATGGAGGTGG CTGGCTTCAGCCCCCTTTCCAGG
Strand - +
Off-target summary No data {0: 545, 1: 595, 2: 365, 3: 259, 4: 625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!