ID: 1091712243_1091712253

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1091712243 1091712253
Species Human (GRCh38) Human (GRCh38)
Location 12:2750264-2750286 12:2750316-2750338
Sequence CCTGCTGGTCTCCATGGAGGTGG TGGCTTCAGCCCCCTTTCCAGGG
Strand - +
Off-target summary No data {0: 544, 1: 578, 2: 353, 3: 262, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!