ID: 1091811872_1091811879

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1091811872 1091811879
Species Human (GRCh38) Human (GRCh38)
Location 12:3406182-3406204 12:3406197-3406219
Sequence CCCCTTTTAGCCAAGGATGGAGC GATGGAGCAGCTGGGATTCAGGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 344, 3: 1029, 4: 1747} {0: 1, 1: 12, 2: 266, 3: 799, 4: 1772}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!