|
Left Crispr |
Right Crispr |
| Crispr ID |
1091811872 |
1091811885 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:3406182-3406204
|
12:3406226-3406248
|
| Sequence |
CCCCTTTTAGCCAAGGATGGAGC |
GTTCTGGGGCTACACACAGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 12, 2: 344, 3: 1029, 4: 1747} |
{0: 1, 1: 0, 2: 12, 3: 62, 4: 318} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|