ID: 1092044146_1092044149

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1092044146 1092044149
Species Human (GRCh38) Human (GRCh38)
Location 12:5415335-5415357 12:5415360-5415382
Sequence CCCAATACTATTACAATGGCAAT AATATCAACGTGAGTTTTGGTGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 56, 3: 171, 4: 776} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!