ID: 1092434176_1092434178

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1092434176 1092434178
Species Human (GRCh38) Human (GRCh38)
Location 12:8433173-8433195 12:8433194-8433216
Sequence CCTAGAAAAGTGGAATCATACCG CGTGTTTAATTTTTTTGTTTTGG
Strand - +
Off-target summary No data {0: 14, 1: 12, 2: 4, 3: 82, 4: 1116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!