ID: 1092758685_1092758691

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1092758685 1092758691
Species Human (GRCh38) Human (GRCh38)
Location 12:11789454-11789476 12:11789499-11789521
Sequence CCTGCTTCGGTCTGGGCTTCAGC GTTCACTTTTTCTCTCCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129} {0: 1, 1: 1, 2: 6, 3: 52, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!