ID: 1092770579_1092770586

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1092770579 1092770586
Species Human (GRCh38) Human (GRCh38)
Location 12:11892808-11892830 12:11892839-11892861
Sequence CCTCGGCCTTACTGACAAGGACA GGGTGCAAACAGATGGACTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117} {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!