ID: 1092980089_1092980091

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1092980089 1092980091
Species Human (GRCh38) Human (GRCh38)
Location 12:13786153-13786175 12:13786202-13786224
Sequence CCTCGACTAAACTAAGCAGGTAC CATCCATAGTTATTCAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34} {0: 1, 1: 1, 2: 1, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!