ID: 1093031869_1093031873

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1093031869 1093031873
Species Human (GRCh38) Human (GRCh38)
Location 12:14295939-14295961 12:14295977-14295999
Sequence CCAGTAACAGGCCAACAGCTGTC AGTTATCTGCGGAAGATGGCAGG
Strand - +
Off-target summary No data {0: 3, 1: 190, 2: 192, 3: 119, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!