ID: 1093102469_1093102474

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1093102469 1093102474
Species Human (GRCh38) Human (GRCh38)
Location 12:15044615-15044637 12:15044664-15044686
Sequence CCCAGTGCAGGGAGCAGGCATAA ATTTCCCACTAAAAGAGCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!