ID: 1093181927_1093181930

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1093181927 1093181930
Species Human (GRCh38) Human (GRCh38)
Location 12:15976468-15976490 12:15976486-15976508
Sequence CCCCAGTGACATGGGGGCTAGGT TAGGTTTCTCTCCACCTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 100} {0: 1, 1: 0, 2: 1, 3: 24, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!