ID: 1093561827_1093561846

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1093561827 1093561846
Species Human (GRCh38) Human (GRCh38)
Location 12:20551868-20551890 12:20551913-20551935
Sequence CCCGTCCAACCACTACGGACCCA CATGTGGCGGTTCCGAGTCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 63} {0: 2, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!