ID: 1093639880_1093639886

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1093639880 1093639886
Species Human (GRCh38) Human (GRCh38)
Location 12:21513757-21513779 12:21513803-21513825
Sequence CCACACTATAGCCTGGGCAATAG AAAGAAAAAAGAGAAAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 305, 3: 2321, 4: 4884} {0: 3, 1: 30, 2: 454, 3: 3850, 4: 18659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!