|
Left Crispr |
Right Crispr |
Crispr ID |
1093639880 |
1093639887 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:21513757-21513779
|
12:21513810-21513832
|
Sequence |
CCACACTATAGCCTGGGCAATAG |
AAAGAGAAAGGAAAGGAGAAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 10, 2: 305, 3: 2321, 4: 4884} |
{0: 2, 1: 21, 2: 200, 3: 1737, 4: 9999} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|