ID: 1093639880_1093639887

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1093639880 1093639887
Species Human (GRCh38) Human (GRCh38)
Location 12:21513757-21513779 12:21513810-21513832
Sequence CCACACTATAGCCTGGGCAATAG AAAGAGAAAGGAAAGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 305, 3: 2321, 4: 4884} {0: 2, 1: 21, 2: 200, 3: 1737, 4: 9999}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!