|
Left Crispr |
Right Crispr |
| Crispr ID |
1093646160 |
1093646164 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:21587599-21587621
|
12:21587638-21587660
|
| Sequence |
CCAGCCCTGTGGAACTGTGAGAC |
CTTATAAATTACCCAGTCTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 185, 2: 3435, 3: 7067, 4: 9057} |
{0: 412, 1: 7381, 2: 13906, 3: 14307, 4: 10797} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|