ID: 1093977406_1093977412

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1093977406 1093977412
Species Human (GRCh38) Human (GRCh38)
Location 12:25438321-25438343 12:25438356-25438378
Sequence CCTGCACAACTAGGCCATTGGCC TTTATATATATTTTCACCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64} {0: 1, 1: 1, 2: 14, 3: 107, 4: 964}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!