ID: 1094041176_1094041194

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1094041176 1094041194
Species Human (GRCh38) Human (GRCh38)
Location 12:26122881-26122903 12:26122924-26122946
Sequence CCAGCTTCTGCCCCGCGCGCTCC CCCGGCGGCCGAGGGAGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 271} {0: 1, 1: 0, 2: 3, 3: 33, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!