ID: 1094839463_1094839476

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1094839463 1094839476
Species Human (GRCh38) Human (GRCh38)
Location 12:34336888-34336910 12:34336934-34336956
Sequence CCGGCGCGGCAGAGCAAGGGCCT CCCCCTGCCGCGCATGCGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 21, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!