ID: 1094839467_1094839486

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1094839467 1094839486
Species Human (GRCh38) Human (GRCh38)
Location 12:34336914-34336936 12:34336963-34336985
Sequence CCCCTGGCCAACCCCACACACCC GTTCGCGCTGCCGGAGTTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!