ID: 1095040566_1095040575

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1095040566 1095040575
Species Human (GRCh38) Human (GRCh38)
Location 12:37435880-37435902 12:37435930-37435952
Sequence CCTGAGCCTGCATGGCCTCTTCC GTTTGTCCAAATGGTGCCCAAGG
Strand - +
Off-target summary {0: 13, 1: 2, 2: 2, 3: 39, 4: 307} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!