ID: 1095626584_1095626591

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1095626584 1095626591
Species Human (GRCh38) Human (GRCh38)
Location 12:44321570-44321592 12:44321608-44321630
Sequence CCGACAGGGATGAATCTGGTGAC CTTCCTTGAGAATGGAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 123} {0: 1, 1: 0, 2: 3, 3: 50, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!