ID: 1095626588_1095626593

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1095626588 1095626593
Species Human (GRCh38) Human (GRCh38)
Location 12:44321598-44321620 12:44321638-44321660
Sequence CCCAGAGGTGCTTCCTTGAGAAT CAATCACAGACTTTCACATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182} {0: 1, 1: 0, 2: 2, 3: 12, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!