ID: 1095923028_1095923035

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1095923028 1095923035
Species Human (GRCh38) Human (GRCh38)
Location 12:47550059-47550081 12:47550111-47550133
Sequence CCAGCTACTTGGGAGGTGGAGGT GGCTGCACTGCATTCCATCCTGG
Strand - +
Off-target summary {0: 56, 1: 838, 2: 17253, 3: 121387, 4: 236653} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!