ID: 1095963018_1095963022

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1095963018 1095963022
Species Human (GRCh38) Human (GRCh38)
Location 12:47847193-47847215 12:47847224-47847246
Sequence CCTACTGTCCTCCAGTCCTTCTC ATTCAGCCAACTCTGTCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 404} {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!