ID: 1096308339_1096308347

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1096308339 1096308347
Species Human (GRCh38) Human (GRCh38)
Location 12:50498663-50498685 12:50498699-50498721
Sequence CCTTTAAGCGGTTTTCTGCCCTG TTCCTTGCCCTCATTCCCATGGG
Strand - +
Off-target summary {0: 76, 1: 203, 2: 215, 3: 197, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!