ID: 1096308345_1096308354

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1096308345 1096308354
Species Human (GRCh38) Human (GRCh38)
Location 12:50498692-50498714 12:50498719-50498741
Sequence CCAGGTGTTCCTTGCCCTCATTC GGGTGTTCCACCTTCCGGCATGG
Strand - +
Off-target summary {0: 485, 1: 355, 2: 126, 3: 55, 4: 250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!