ID: 1096389274_1096389280

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1096389274 1096389280
Species Human (GRCh38) Human (GRCh38)
Location 12:51217079-51217101 12:51217099-51217121
Sequence CCCTTCCAGCAACGCCTGGGTCC TCCCTACCCCCGGGTCCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150} {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!