ID: 1096389275_1096389280

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1096389275 1096389280
Species Human (GRCh38) Human (GRCh38)
Location 12:51217080-51217102 12:51217099-51217121
Sequence CCTTCCAGCAACGCCTGGGTCCC TCCCTACCCCCGGGTCCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 183} {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!