ID: 1096396395_1096396406

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096396395 1096396406
Species Human (GRCh38) Human (GRCh38)
Location 12:51269861-51269883 12:51269902-51269924
Sequence CCCCTCCGGGCCTGCTTTCGCCG CACAGCCTGCCAAGCCTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 97} {0: 1, 1: 0, 2: 3, 3: 20, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!