ID: 1096530460_1096530471

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1096530460 1096530471
Species Human (GRCh38) Human (GRCh38)
Location 12:52239491-52239513 12:52239524-52239546
Sequence CCCTTTATCCCTTCTGGACTCAG CAGGCTAAGGATTCGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 211} {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!