ID: 1096673557_1096673570

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1096673557 1096673570
Species Human (GRCh38) Human (GRCh38)
Location 12:53214397-53214419 12:53214445-53214467
Sequence CCCAAAGTGAAGAGTGCCCTGCC CCGTGGTATACTTGCCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 120} {0: 1, 1: 0, 2: 0, 3: 4, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!