ID: 1096956637_1096956642

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1096956637 1096956642
Species Human (GRCh38) Human (GRCh38)
Location 12:55532868-55532890 12:55532913-55532935
Sequence CCAAGCATCTTCTGTCTTGAAGA TCACATAAACTGAAGGTAAAGGG
Strand - +
Off-target summary No data {0: 5, 1: 338, 2: 491, 3: 463, 4: 993}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!