ID: 1097107065_1097107082

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1097107065 1097107082
Species Human (GRCh38) Human (GRCh38)
Location 12:56632252-56632274 12:56632305-56632327
Sequence CCCCAAATAAAAAATTAAGGCAG GGGCGGCGGGATGGGGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 782} {0: 1, 1: 0, 2: 6, 3: 112, 4: 948}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!